Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_102034 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Rheumatoid Arthritis (RA) | ICD-10 | #N/A (M06.9) |
DBLink | Link to database | PMID | https://academicjournals.org/journal/AJB/article-full-text/9E8BCC658072 |
Experimental Method | |||
Sample Type | Peripheral blood lymphocytes | Comparison | Three RA patients (1 man and 2 women; age range of 50 to 62 years). As controls, three healthy volunteers were recruited (1 man and 2 women; age range of 49 to 63 years). |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTCATCTGTATAGTGTATGCCGTTA ReverseCAGCTGGAATGGTGATTTCTT | Statistics | Fold Change : Downregulated pvalue : <0.05 |
Citation | |||
https://academicjournals.org/journal/AJB/article-full-text/9E8BCC658072 |